| Field | Specification |
|---|---|
| Alternative names | ISIS 505358 |
| CAS no. | |
| Applications | |
| Molecular weight | |
| Purity | |
| Form | Solid |
| Storage | |
| Shipping | |
| Catalog no. (Mfr.) | |
| Main SKU |
Compound Overview
Bepirovirsen, also known as ISIS 505358, is an antisense oligonucleotide that targets all HBV messenger RNAs. It reduces HBV-derived RNAs, HBV DNA, and viral proteins, and it can be used in research on chronic HBV infection; its binding site sequence is GCACTTCGCTTCACCTCTGC[1]. It is supplied as a white to off-white solid (MW 7344.00) at 97.10% purity.
Physical & Chemical Properties
| CAS Number | 1403787-62-1 |
|---|---|
| Molecular Weight | 7344.00 g/mol |
| Purity | 97.10% |
| Appearance | Solid |
| Color | White to off-white |
| Sequence | DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC) |
| Signaling Pathway | Anti-infection |
| Solubility | In Vitro: H2O: ≥ 20 mg/mL (2.72 mM) * "≥" means soluble, but saturation unknown. |
| Storage | -20°C, sealed storage, away from moisture. In solvent: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). |
| Shipping | Room temperature in continental US; may vary elsewhere. |
Literature Cited
Sources cited in this description and in the In Vitro & In Vivo Data tab. Peer-reviewed publications that used this product are listed under References.
Safety
For Research Use Only. Not for use in diagnostic or therapeutic procedures, and not for human or veterinary use. Handle in accordance with the Safety Data Sheet and your institution's chemical hygiene plan.
In Vitro
| Solvent | Solubility | Notes |
|---|---|---|
| H2O | ≥ 20 mg/mL (2.72 mM) | — |
Aliquot the stock solution and store it at -80°C (up to 6 months) or -20°C (up to 1 month); sealed storage, away from moisture; avoid repeated freeze-thaw cycles.
If water is used as the stock solvent, dilute to the working solution and sterilize it through a 0.22 μm filter before use.
Data provided by the manufacturer.
In Vitro
In HepG2.2.15 cells, Bepirovirsen (16-250 nM; 16 h) lowers hepatitis B virus (HBV) RNA, DNA, and viral proteins[1].
In Vivo
In HBV-transgenic mice, Bepirovirsen lowers hepatic HBV RNA and DNA at 22-50 mg/kg/week (s.c., twice weekly in week 1 and once weekly in weeks 2-4)[1].
| Animal Model | Male HBV transgenic mice (Tg[HBV 1.3 genome]Chi32 against C57BL/6 background) aged 7-12 weeks and weight 18-25 g[1]. |
|---|---|
| Dosage | 22, 50 mg/kg/week |
| Administration | Injected subcutaneously twice weekly for week 1 and once weekly for weeks 2-4 |
| Result | Dose-dependently reduced hepatic levels of HBV DNA and HBV RNA in HBV transgenic mice. Reduced levels of serum HBV DNA, serum HBsAg and serum HBeAg. |
Data provided by the manufacturer. Numbered citations refer to the Literature Cited list in the product description.
Need this compound in a format that drops straight into your assay? We can tailor formulation, chemistry, and documentation so your results stay consistent across runs and re-orders.
- Format options: solid or pre-dissolved solution (choose solvent), target concentration, aliquots, light/moisture-protected packaging
- Chemistry options: free base/acid vs salt forms, hydrate/solvate preference, stereoisomer control (single enantiomer or racemate), close analogs
- Add-on labels & handles: D/¹³C/¹⁵N isotopes (LC-MS/internal standards), azide/alkyne or other functional handles for conjugation
- QC & documentation: standard COA or enhanced analytical pack (HPLC/LC-MS/NMR), chiral purity, residual solvents, water content (KF), method-specific specs
- Scale & continuity: mg to gram scale, bulk pricing, lot reservation, repeat-order continuity
To quote quickly, tell us: compound name + CAS/structure (SMILES or mol file), intended assay context, solvent preference, salt/stereochemistry requirements, purity/QC level, and the amount (mg–g).
Can’t find the compound you’re looking for?
Send the CAS or structure and your specs. We can help source it, suggest close equivalents, or discuss custom synthesis with the right QC documentation (RUO).
