MM.1S cell

SKU:BHC11101504
Bulk Pricing
Overview
Click light‑blue chips for details

MM.1S cell is a B cell cell line derived from African American (Female). It is commonly used as an in vitro model for 1 research. Growth characteristics: Mixed: loosely attached monolayer and suspension, Lymphoblast. Supplied as cryopreserved cells with accompanying batch CoA and quality-control documentation.

Species Human
Disease model Multiple myeloma
Morphology Lymphoblast
Growth Properties Mixed: loosely attached monolayer and suspension
Tissue Peripheral blood
Options selector
Catalog no. Size
305304 1 cryovial
Available Options

This cell line is available in the U.S. For non-profit users, please sign and submit the Non-Profit Supply Agreement to orders@biohippo.com before placing an order. For commercial users, please complete the CLEAR Form before ordering, as additional usage fees may apply based on the intended use. For further details, please contact orders@biohippo.com. Products ship after the required agreement is completed; typical delivery is 2–3 business days. Products are shipped frozen on dry ice in cryotubes. Each cryotube typically contains 3 × 10^6 cells for adherent lines or 5 × 10^6 cells for suspension lines (refer to the batch CoA for details).

Field Specification
Cellosaurus CVCL_8792
Species Human
Applications
  • Cell Culture (Growth)
  • Functional Assay
Classification Myeloma cell lines
Tissue
  • Peripheral blood
Disease Multiple myeloma
Age 45 years
Sex Female
Ethnicity African American
Growth properties
  • Mixed: loosely attached monolayer and suspension
Biosafety level 1
Catalog no. (Mfr.) 305304
Main SKU BHC11101504
The MM.1S cell line is part of the MM.1 series, which was developed from a single patient with multiple myeloma (MM) to study various stages of disease progression and response to glucocorticoid (GC) therapy. MM.1S is specifically sensitive to glucocorticoids, such as dexamethasone, and serves as a model to investigate the mechanisms of GC-induced apoptosis in multiple myeloma cells. This sensitivity makes MM.1S a crucial tool for studying the early phases of MM treatment and the cellular pathways leading to GC responsiveness. MM.1S cells, like other MM.1 lines, exhibit typical myeloma morphology, including round cells with eccentrically located nuclei, many of which are binucleated or multinucleated. These cells express characteristic markers of plasma cells, such as CD38 and PCA-1, while lacking typical B-cell markers like CD19 and CD20, reflecting their terminally differentiated status as plasma cells. They also exhibit high levels of immunoglobulin lambda (λ) light chain expression, consistent with their origin. This cell line has been vital for exploring pathways of drug action, resistance, and apoptosis in MM, especially in the context of GC treatment. One of the key features of MM.1S is its reliance on functional glucocorticoid receptors (GR) for drug responsiveness. In MM.1S, high levels of wild-type GR enable dexamethasone to induce apoptosis effectively, providing a valuable system for studying the molecular events underlying this process. This line is often compared to its resistant counterpart, MM.1R, to investigate the mechanisms of GC resistance, a critical issue in the treatment of MM. Together, the MM.1S cell line offers insights into drug sensitivity, disease progression, and potential therapeutic strategies for multiple myeloma.

SKU:BHC11101504

  • Products: IgA lambda
  • Mutational profile: Mutation: KRAS, p.Gly12Ala (c.35G>C), heterozygous; Mutation: TRAF3, p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA), homozygous
  • cultureMedium: RPMI 1640, w: 2.0 mM stable Glutamine, w: 2.0 g/L NaHCO3 (Cytion article number 820700a)
  • supplements: Supplement the medium with 10% heat-inactivated FBS
  • dissociationReagent: Accutase
  • subculturing: Gather the suspension cells in a 15 ml tube and gently wash the adherent cells with PBS lacking calcium and magnesium (use 3-5 ml for T25 flasks and 5-10 ml for T75 flasks). Apply Accutase (1-2 ml for T25 flasks, 2.5 ml for T75 flasks) ensuring full coverage of the cell layer. Allow the cells to incubate at room temperature for 10 minutes. Following incubation, combine and centrifuge both the suspension and adherent cells. After centrifugation, carefully resuspend the cell pellet and transfer the cell suspension into new flasks containing fresh medium.
  • freezeMedium: As a cryopreservation medium, use complete growth medium (including FBS) + 10% DMSO for adequate post-thaw viability, or CM-1 (Cytion catalog number 800100), which includes optimized osmoprotectants and metabolic stabilizers to enhance recovery and reduce cryo-induced stress.

Get a Quote

Please use this form for bulk quantity requests or customized products.

Contact Information

Product Information

Try Celltrypse Free – Request Your Sample Today

Experience the power of Celltrypse™, c-LEcta's innovative enzyme solution for gentle and efficient cell dissociation. Request your free sample and discover a superior alternative for your cell culture workflows.

Try Celltrypse Free – Request Your Sample Today

Try Celltrypse Free – Request Your Sample Today

Experience the power of Celltrypse™, c-LEcta's innovative enzyme solution for gentle and efficient cell dissociation. Request your free sample and discover a superior alternative for your cell culture workflows.

Try Celltrypse Free – Request Your Sample Today