| Field | Specification |
|---|---|
| Analyte | |
| Analyte category | |
| Organism | |
| Applications | |
| Assay type | |
| Assay target | |
| Assay area | |
| Target type | |
| Detection method | |
| Detection instrument(s) | T7 RNA Polymerase; NTPs (ATP; GTP; CTP; UTP); transcription buffer; RNase inhibitor |
| Plate format | |
| Storage | |
| Shipping | |
| Catalog no. (Mfr.) | |
| Main SKU |
Background
Bacteriophage T7 RNA Polymerase is a 99 kDa protein that recognizes T7 phage promoters with high specificity and subsequently initiates transcription. T7 RNA polymerase is a single subunit, highly processive and stable enzyme, characteristics that make it suitable for a broad range of biochemistry and molecular biology applications. Description The Aurora T7 RNA Polymerase In Vitro Transcription Kit is a quick and easy approach to generate large amounts of RNA in vitro. The RNA product from the kit is suitable for RNA structural, functional, and enzymatic (ie. ribozyme) studies, production of RNA probes for hybridization blotting or RNase protection assays, RNA vaccine production, microarray and microinjection, anti-sense RNA and RNAi experiments, and in vitro translation. The assay is fast and convenient, and requires the T7 RNA polymerase, NTP mix (UTP, ATP, CTP, and GTP), reaction buffer, and a suitable DNA template. The modified nucleotide N1- Methyl-Pseudo UTP is incorporated in our T7 RNA Polymerase In Vitro Transcription Kit-II. Figure 1 illustrates the T7 transcription with T7 promoter sequence and the transcription start site. T7 Promoter +1 (Transcription Start Site) 5’ TAATACGACTCACTATAGGG 3’ ATTATGCTGAGTGATATCCC RNA Transcript 5’ GGG T7 Transcription 3’ 5’ 3’ Figure 1. T7 RNA transcription Materials Supplied Catalogue No. K777627-E K777627-B K777627-A K777627-G K777627-C K777627-U K777627-T K777627-H
Kit Components
| Catalog No. | Item | Amount | Storage |
|---|---|---|---|
| T7 RNA Polymerase MIX | 0.5 ug | -20C | |
| Stability |
Assay Protocol
- Step 1. Set up reactions for RNA synthesis 1) Thaw the kit components on ice and briefly spin the tubes to recover the full contents at the bottom of the tube. For T7 RNA polymerase, make aliquots of the enzyme for single use. Store remaining aliquot protein at -80°C. 2) Assemble the reaction at room temperature in the following order:
Data Analysis
Kb 20 40 60 80 100 120 140 Reaction Time, Minutes Related products: Catalog # 5727-4121NK 5727-4122NK 5727-4123NK 5727-4133NK 5727-4127NK 5727-4128NK 5727-4121BK 5727-4122BK 5727-4123BK 5727-4127BK 5727-4128BK Product Name Kras WT Nucleotide Exchange Assay Kit Kras G12C Nucleotide Exchange Assay Kit Kras G12D Nucleotide Exchange Assay Kit Kras G13D Nucleotide Exchange Assay Kit Kras G12R Nucleotide Exchange Assay Kit Kras G12V Nucleotide Exchange Assay Kit Kras WT–cRAF Binding Assay Kit Kras G12C–cRAF Binding Assay Kit Kras G12D–cRAF Binding Assay Kit Kras G12R–cRAF Binding Assay Kit Kras G12V–cRAF Binding Assay Kit 728203 728253 728263 728273 362101 K777627 756981BK 759331BK 34343BK 810030 910010 SARS-CoV-2 Mpro (3CL Protease) Assay Kit SARS-CoV-2 Papain-like Protease Assay Kit SARS-CoV-2 Nucleocapsid Protein Binding Kit (For mouse antibody) SARS-CoV-2 Nucleocapsid Protein Binding Kit (For rabbit antibody) DNA Polymerase Theta Activity Assay Kit T7 High Yield RNA Synthesis Kit PKMYT1 Binding Assay Kit WEE1 Binding Assay Kit eIF4E/eIF4G Binding Assay Kit Caspase-3 Activity Assay Kit IDO1 Activity Assay Kit for Inhibitor Screening Size 384 reactions 384 reactions 384 reactions 384 reactions 384 reactions 384 reactions 384 reactions 384 reactions 384 reactions 384 reactions 384 reactions 96 reactions 96 reactions 384 reactions 384 reactions 96 reactions, 384 rec 25, 50, 100 reactions 384 reactions 384 reactions 384 reactions 384 reactions 96 reactions 3 T7 High Yield RNA Synthesis Kit 5727-4122G Kras G12C, GST-tag Kras G12D, GST-tag, GDP Loaded 5727-4123G-G 5727-4128G-GP Kras G12V, GST-tag, GppNHp loaded 7671 7671HA 7237231 SOS1, No tag SOS1, His-Avi-tagged Human RBD-RAF1, N-His tag, C-FLAG tag 180001 180002 180003 12-0009MH 12-0009H 12-0009M 12-0009 12-0010 12-0011 12-0012 7657643 7657283 C352E1-10 C352A2-10 225201-1 62581 232340 2323405 2323155 236940 2369405 2344875 237351 56781 52352-FL 5756981-FL 5756981-CDD 5756981-CDP Recombinant Human Malic enzyme 1 (ME1) Recombinant Human Malic enzyme 2 (ME2) Recombinant Human Malic enzyme 3 (ME3) Recombinant His-tagged Human MNK2 D228G Recombinant His-tagged Human MNK2 Recombinant Human MNK2 D228G Recombinant Human MNK2 His-tagged Human eIF4E His-tagged Human eIF4E Complexed With EIF4G His-tagged Human eIF4E Complexed With m7GTP DNA Polymerase Theta-N-Helicase Domain DNA Polymerase Theta-C terminal Domain GST-CDK2:his-CyclinE1 GST-CDK2:His-CyclinA2 Recombinant Human BCL2 Human MALT1 (caspase-IG3) Recombinant Human CD40 Recombinant Human CD40L Recombinant Human CD155 Recombinant Human OX40 Recombinant Human OX40L Recombinant Human GITRL Recombinant Human PD-L1 Recombinant Full-length Human MST1 Recombinant Human CDK2 Recombinant Human Full Length PKMYT1 Recombinant Human PKMYT1, catalytic domain – dephosphorylated Recombinant Human PKMYT1, catalytic domain – phosphorylated 50 µg, 100 µg 50 µg, 100 µg 50 µg, 100 µg 100 µg, 1 mg 100 µg, 1 mg 100 µg 10 μg, 100 µg, 500 µg, 1 mg 10 μg, 100 µg, 500 µg, 1 mg 10 μg, 100 µg, 500 µg, 1 mg 10 µg, 100 µg 10 µg, 100 µg 10 µg, 100 µg 10 µg, 100 µg 50 µg, 100 µg 50 µg, 100 µg 50 µg, 100 µg 20 µg, 100 µg 20 µg, 100 µg 10 µg 10 µg 100 µg 20 µg 100 µg 100 µg 100 µg 100 µg 100 µg 100 µg 100 µg 10 µg, 50 µg, 100 µg, 500 µg 50 µg, 500 µg 10 µg, 50 µg, 100 µg, 500 µg 10 µg , 50 µg, 100 µg, 500 µg 10 µg , 50 µg, 100 µg, 500 µg Products are for research use only and are not intended for human use.
Biological Pathway / Process
In Vitro Transcription
Therapeutic / Disease Area
RNA Therapeutics; Gene Therapy; Vaccine; General
▶▼What activity does the T7 High Yield RNA Synthesis Kit measure?
This kit measures T7 RNA Polymerase (bacteriophage T7 RNAP) enzymatic activity using a fluorescence-based format. The assay is designed for cell-free, homogeneous conditions that support both endpoint and kinetic measurements, and is suitable for IC₅₀ determination of inhibitor candidates.
▶▼What instrument or plate reader is required?
A fluorescence microplate reader is required to read this assay. The specific excitation and emission wavelengths depend on the detection mode used. Please refer to the product datasheet for exact instrument settings and compatible reader models.
▶▼How many reactions are included, and is bulk ordering available?
This kit is available in 25 reactions and 50 reactions and 100 reactions. Each reaction is conducted in a Tube / 96-well format, making it directly compatible with standard liquid-handling robotics for HTS applications. For bulk orders or custom quantities, please contact BioHippo or submit a quote request — distributor pricing is available.
▶▼Has the assay performance been validated?
Yes. Aurora Biolabs validates each kit using reference compounds to confirm assay window, signal-to-background ratio, and reproducibility prior to release. Specific validation data are provided in the product datasheet. Users are encouraged to determine the Z′ factor under their own experimental conditions.
▶▼What are the storage and shipping requirements?
The kit ships on 4°C and should be stored at -20°C upon receipt. Individual components may have different storage requirements — please refer to the component table in the datasheet. Protein components are sensitive to freeze–thaw cycles; aliquot on first thaw and avoid repeated freeze–thaw.
Need a different assay kit format or extra support beyond the catalog item? We offer customization and add-on services for assay kits to better fit your target, workflow, and detection platform. Options may include assay format customization (biochemical, binding, or cell-based), detection method selection such as TR-FRET, fluorescence polarization, luminescence, or colorimetric readout, target-specific reagent development including recombinant proteins, conjugates, antibodies, substrates, tracers, and controls, as well as protocol optimization for sensitivity, specificity, signal window, and reproducibility. We can also support kit component adjustments, plate format and scale options, QC and validation packages, bulk or custom packaging, and related assay development services when a standard kit does not fully meet your needs. Click Talk to a Scientist to submit a request, email us at support@biohippo.com, or explore our Research Services for additional support. Our team will be in contact with you shortly.