| Field | Specification |
|---|---|
| Applications | |
| Source | Recombinant (E. coli) |
| Storage | |
| Shipping | |
| Catalog no. (Mfr.) | |
| Main SKU |
TelN Protelomerase is a recombinant expression from phage N15. It cuts double-stranded DNA (dsDNA) at TelN recognition sequences (56 bp), and generates covalently closed ends at the cleavage sites, which can be applied to enzymatic synthesis of DNA.
Features
Excellent cut-and-paste performance.
The integrity of dsDNA product end closure is greater than 90%.
Applications
DNA Enzymatic Synthesis.
Specifications
|
Unit Definition |
One unit is defined as the amount of enzyme that will convert 0.5 μg of supercoiled plasmid containing telN recognition sites into closed linear dsDNA, in 20 μL reaction system containing 1 X TelN Reaction Buffer at 30oC for 30 minutes. |
|
Recognition Sites |
TATCAGCACACAATTGCCCATTATACGC↓GCGTATAATGGACTATTGTGTGCTGATA ATAGTCGTGTGTTAACGGGTAATATGCG↑CGCATATTACCTGATAACACACGACTAT |
|
Heat Inactivation |
75℃ for 5 min |
Glycerol Content |
Contains Glycerol |
Components
|
Components No. |
Name |
14540ES72 |
14540ES80 |
14540ES90 |
|
14540-A |
TelN Protelomerase (5 U/μL) |
50 μL |
200 μL |
1 mL |
|
14540-B |
10 X TelN Reaction Buffer |
250 μL |
1 mL |
5 X 1 mL |
Shipping and Storage
This product should be stored at -25 ~ -15oC for 1 years.
Figures
Figure 1.Protelomerase cleavage activity detection of TelN M:Marker, C: supercoiled plasmid control

Figure 2.TelN Protelomerase end closure integrity test. C1: plasmid containing TelN recognition site, without TelN Protelomerase; C2: plasmid containing TelN recognition site, TelN Protelomerase, without T5 exonuclease; Plasmid: plasmid containing TelN recognition site.
Store this enzyme at -20°C and avoid repeated freeze-thaw cycles to preserve catalytic activity. The product is shipped Dry Ice and remains stable for up to one year from the date of manufacture when stored under recommended conditions. Aliquoting the stock solution into single-use volumes is recommended for enzymes used infrequently to minimize thermal cycling of the bulk stock.
DNA Enzymatic Synthesis .. Always verify compatibility with your specific template, buffer, and downstream workflow.
Activity is expressed in units (U) or µg/µL depending on enzyme class; functional validation is performed using standard end-repair or fill-in assays on defined DNA substrates.
This enzyme is produced as Recombinant (E. coli) and supplied as a Research Use Only (RUO) reagent. Each lot is subjected to activity assay, purity assessment by SDS-PAGE, and functional validation prior to release. A Certificate of Analysis (CoA) and Safety Data Sheet (SDS) are available on request.
NGS end-repair typically requires three activities: 5′→3′ exonuclease to remove 5′ overhangs, 3′→5′ exonuclease to remove 3′ overhangs (generating blunt ends), and 5′-kinase activity to phosphorylate blunt ends for adapter ligation. Some formulations include A-tailing (3′ adenylation) activity. Combining these activities in a single-enzyme or master mix format reduces workflow steps and minimizes DNA loss between reactions.
Yeasen Biotechnology supports custom enzyme solutions across multiple service lines — from GMP-grade bulk supply to directed enzyme engineering. Contact BioHippo to discuss requirements and initiate a project inquiry.
▶ GMP-Grade & Bulk Supply
Select Yeasen enzymes are available in GMP grade, manufactured in an ISO 13485-certified UCF.ME™ ultra-clean molecular enzyme facility with FDA Drug Master File (DMF) support.
- GMP-grade release testing and CoA documentation
- ISO 13485-certified production facility
- Scalable from milligram to multi-gram quantities
- Consistent lot-to-lot activity specifications
▶ Glycerol-Free & Custom Formulation
Glycerol-free enzyme formats are available for applications requiring lyophilization compatibility, liquid handling automation, or direct IVD master mix integration.
- Glycerol-free liquid format (standard and custom buffers)
- Lyophilization-ready enzyme preparation
- Custom reaction buffer optimization for specific assay conditions
- Compatible with freeze-drying workflows for point-of-care formats
▶ Molecular IVD RDC Service
Yeasen's Research and Development Contracting (RDC) team delivers end-to-end solutions for molecular diagnostic product development, covering enzyme selection through clinical validation support.
- Enzyme selection and performance matching
- Primer/probe design and reaction buffer optimization
- Sensitivity, specificity, and precision validation studies
- Stability studies and SNP evaluation
- Instrument platform compatibility assessment
▶ ZymeEditor™ Enzyme Engineering
Yeasen's proprietary ZymeEditor™ directed evolution and rational design platform enables the development of custom enzyme variants with tailored performance characteristics not available in off-the-shelf products.
- Directed evolution for enhanced thermostability, processivity, or fidelity
- Rational design for altered substrate specificity or cofactor requirements
- Library screening from Yeasen's proprietary enzyme variant collection
- Scale-up to commercial quantities upon candidate confirmation
ⓘ Customization services are fulfilled by Yeasen Biotechnology. Lead times and minimum order quantities vary by service type. Contact BioHippo for project scoping and pricing.